EST details — SGN-E306196

Search information 
Request: 306196Match: SGN-E306196
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95796Clone name: cLEY-13-F1
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192818 [TUS-66-J16] Trace: SGN-T345202 EST: SGN-E544327 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192818 [TUS-66-J16] Trace: SGN-T349899 EST: SGN-E549024 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306196Length: 410 bp (950 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306196 [] (trimmed) CTTTCAGCCATTAATGGACCTTGAAGCTGTTCTTACCCACTTCGATTCATGCTGGTTTAATCTCGAAATTCTCAATAATCATTCAAATTCAACCC
CTTTTTCGAATTACCAGAAAAACCCAGATGACAAAATTCAAGAAAATTTAACAGAATCTGTATATGATTCACCAAATTTAGAAATCAAAACAGAG
TCACAGAGTGATGATTTGAGCTACGATTCGGATTCTGTTTCACCAGATACAGTTCTACCAGTGACCCATTTTCAACCATTCTGTAAAAATGCAGA
ATCAAAGAAAGTAAAAGGTAGAAGAAGAAGAAGAGAAAAGTGTCTTGGCAAGAGCTTATCGGAGCTAGAATATGAAGAGCTAAAAGGGTTTATGG
ATCTTGGATATGAATTCTCAGAAGATGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306196] SGN-U594714 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119374 [Download][View] Facility Assigned ID: TRYBY25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5