EST details — SGN-E306471

Search information 
Request: 306471Match: SGN-E306471
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93123Clone name: cLEX-13-M1
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C185190 is on microarray TOM1: SGN-S1-1-5.4.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185190 [TUS-46-L20] Trace: SGN-T192029 EST: SGN-E390703 Direction: 5' Facility: INRA
Clone: SGN-C185190 [TUS-46-L20] Trace: SGN-T192275 EST: SGN-E390949 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306471Length: 560 bp (1081 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306471 [] (trimmed) TCTAACCCAAAATTCAAACAAGGACTTGCAACTATCAAAAACCAAAAACAACTCAATTTTGATTTTCTTTTCATTTTCTCTCTCTAGATATTAGA
AAATTCTAGACTAGACAACCTACTGTAGTTTCCCCCACAAGCCCCCACCATCTCATTTCTAATCATCCTGTTGTCCTTATTCTAAATTTCACATC
ATGAAAAAAGAGTTGAAAACCGAAAATAATAACAGTAACGGTAACAAGCGGTCCCGAGTTGAGTCAGGATTAGACTCAGCTGGTGACTCGCCTGA
GTCTAAGCGAGTTAACACAGAGGTTGAGACAGATCCTGACTCGTCCGAGTCGAGAGTGAGTCCCAACCGTTCAAACTCGCCGGAATCGGATGATG
TGCAAACAGATGTGTACCTGGATTCAACGGAGGCCAAGCAGATCAGAGAAGATATATTGGATATCTTAGATGAGCCTGATGCTCTGACGGAATGT
CCTCCGGAGATTCAGGATCTGGACTCTGTCATGAAGAGTTTCGAGGAAGAGATCCTTCACCACTCACCTTTGAACGATACACAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306471] SGN-U566840 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117564 [Download][View] Facility Assigned ID: TRXBW73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5