EST details — SGN-E307233

Search information 
Request: 307233Match: SGN-E307233
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96401Clone name: cLEY-15-N18
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: Alias clone SGN-C182496 is on microarray TOM1: SGN-S1-1-3.4.8.19
This clone has been mapped as cLEY-15-N18.
Additional sequencing 
Clone: SGN-C182496 [TUS-39-L14] Trace: SGN-T1727 EST: SGN-E378607 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182496 [TUS-39-L14] Trace: SGN-T191548 EST: SGN-E390222 Direction: 5' Facility: INRA
Clone: SGN-C182496 [TUS-39-L14] Trace: SGN-T191772 EST: SGN-E390446 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307233Length: 411 bp (1058 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307233 [] (trimmed) GTGAAGTTACAATGGACTCTCTGAATGCTTACGCATCGTCGGCGGCGATGGCGCAGCAAACCTGGGAGTTAGAGAACAACATCGTAACAATCGAC
GCGCCGTCGGGGTCGAAACCGGAAAACTCCGCGTCGGACGCTATATTCCACTACGACGATGCGGCACAGACGAAGTTTCAGCGGGAGAAGCCGTG
GGCGAGTGACCCTCACTACTTCAAGCGTGTGAAGATCTCTGCTCTTGCTCTTCTCAAGATGGTTGTTCACGCGCGTTCCGGAGGTACAATTGAGG
TCATGGGACTCATGCAGGGTAAGACTGACGGCGATGCCATCATTGTAATGGACGCTATTGCCCTCCCCGTTGAAGGCACTGAAACTAGGGTTAAT
GCTCAAGCTGATGCGTATGAATATATGGTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307233] SGN-U585560 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119656 [Download][View] Facility Assigned ID: TRYCH81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0186 Quality Trim Threshold: 14.5