Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E309844

Search information 
Request: 309844Match: SGN-E309844
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98593Clone name: cLEZ-10-M10
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193422 [TUS-68-C20] Trace: SGN-T346239 EST: SGN-E545364 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193422 [TUS-68-C20] Trace: SGN-T346240 EST: SGN-E545365 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309844Length: 255 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309844 [] (trimmed) GCCTTTCTTCAACTTCTAAAGAATTTTTCTGCGGAACTATACATACAGCTTTCTGTATATATAGATTCGTGATTTCAAAAACCCTAAAAATGGTG
CAGTTGTAGAGAGAGAAAATTGAGCTATAGCTTGGCGATGTTGGAGAGGTGGTGCGGAACTCGAGGTAAAGATTCCCGTCTTTGTAACTTTAACC
CGGACTCGATTCTCAACATTGACTGTGCGAGAAATGCCTACGTCACCTGAAGAAAACCCTAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309844] SGN-U573600 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122514 [Download][View] Facility Assigned ID: TRZBL77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5