EST details — SGN-E310238

Search information 
Request: 310238Match: SGN-E310238
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C113100Clone name: cTOA-1-E13
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182603 is on microarray TOM1: SGN-S1-1-8.1.6.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182603 [TUS-40-A1] Trace: SGN-T1737 EST: SGN-E378445 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182603 [TUS-40-A1] Trace: SGN-T191561 EST: SGN-E390235 Direction: 5' Facility: INRA
Clone: SGN-C182603 [TUS-40-A1] Trace: SGN-T191782 EST: SGN-E390456 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310238Length: 551 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E310238 [] (trimmed) GGGTCTACAGCTGTGTAGATTTGGGGGCGGGGGTGAATATTGATGATCAGGAGATTCACATTTCCAACCAATGTACTTGATCATTATCAGGGCTG
AATCGAAGTGTCGGTGAATAGAGGAGATAATGAGTAGAACTATGAGTCTTGAAGAAAATGATCATTTGCATGTTAGGTACCTGAATAGAGACCCA
AAAACAAATCAAAGATTCACCAAAAACTATCTGTATTCTTTGTAGTACCAACTATGAAGAGTAAATCCTTTCTCCTAATAATAGTTGTTTGGTTT
GTCATTTAGGACATGAGGCATCTCCTCTTTTTGTCAACTAGGCAGTGTTGAAAAAGGAGATACTGCTATATCTGGATAATTCCAACTGGTATCCC
AAATCTCTTGGTACCTAGTCTTGCTTCTCCAACTCCCTAGGGAAAGCTAGAGATCTTGCCCGTCCCCAAGCCGAACAAAACTAAATAGATAGCAA
ATGGTCCTTCAAAAGTAGTTTACATCTTACTTTATATCAGACTAGATCCATACCAAGTCTAAATTTGGAGAACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310238] SGN-U576997 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124161 [Download][View] Facility Assigned ID: TFAAA31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5