EST details — SGN-E323982

Search information 
Request: 323982Match: SGN-E323982
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C127825Clone name: cTOC-3-D21
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182848 is on microarray TOM1: SGN-S1-1-3.3.6.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182848 [TUS-40-K6] Trace: SGN-T187872 EST: SGN-E375978 Direction: 3' Facility: INRA
Clone: SGN-C182848 [TUS-40-K6] Trace: SGN-T187873 EST: SGN-E375979 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E323982Length: 511 bp (909 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E323982 [] (trimmed) GGGGGGATCAAGAAACATTTGGGGCCCATATTCTCCATATCTAGTCTTGTTTTCATGGGCACTTTCTGCTCATCTCTATTTAGCTATAGCACAAA
GATCCACTTATATTGTCCATTTGGACAAATCTTTAATGCCTAATGTCTTTACTGATCACCATCATTGGCATTCTTCTACTATTGATTCCATCAAA
GCTTCTGTTCCTTCATCAGTAGACAGATTCCACTCTGCTCCAAAACTTGTTTACTCTTATGATCATGTGTTTCATGGCTTCAGTGCTGTTTTGTC
CAAAGATGAACTGGCAGCGTTGAAGAAGTCACCAGGTTTCATTTCAGCTTATAAAGACAGAACTGTGGAACCTGACACTACTTACACATTTGGTT
ACCTGAAGCTCAATCCTTCATACGGGTTATGGCCAGCTTCTGGTTTAGGCCAAGATATGATCATTGGTGTTCTTGACAGTGGCATCTGGCCCGAA
TCTGCAAGTTTTCAAGATGACGGTATTCCTGAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E323982] SGN-U581404 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136555 [Download][View] Facility Assigned ID: TFCAK23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0159 Quality Trim Threshold: 14.5