EST details — SGN-C32439

Search information 
Request: 32439Match: SGN-C32439
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C32439Clone name: cLEG-1-I3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183697 is on microarray TOM1: SGN-S1-1-2.2.1.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183697 [TUS-42-N15] Trace: SGN-T195083 EST: SGN-E393757 Direction: 5' Facility: INRA
Clone: SGN-C183697 [TUS-42-N15] Trace: SGN-T195083 EST: SGN-E399423 Direction: 5' Facility: INRA
Clone: SGN-C183697 [TUS-42-N15] Trace: SGN-T195084 EST: SGN-E393758 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248370Length: 532 bp (871 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248370 [] (trimmed) CAAATTTGGCAGAGTACCAAGGGAATGAAAAGATTGTGATTCGACGTTATAGTGATTTTGTATGGTTACACGATCGGCTTTTTGAGAAATACAAG
GGTATTTTTATTCCTCCACTTCCAGAGAAGAGCACTGTAGAAAAGTTCAGATTTAGTGCAGAATTTATTGAAATGAGGCGCCAAGCTCTGGATGT
GTTTGTAAACAGAATAGCTTCACATCATGAACTTCGGCAAAGTGACGATTTGAGAATCTTCTTGCAGGCTGATGAACAGACAATGGACAGAGCAA
GGTTCCAGGAGACTGGTATTTTCAAGAAAAAGCCTGCAGATTTGATCCAAATCTTTAAGGATGTCCAATCTAAAGTGAGTGATGTTGTTCTTGGG
AAGGAAAAGCCAGTTGAAGAATCAACCCCAGAATATGAGAAGATGAAGAACTACATCTTTGAGCTTGAGGAGCATTTAGCTGAGGCTCAAAAGCA
TGCATATCGTCTTGTCAAGAGGCACAGAGAGTTGGGCGAGTCTCTCTCAGACTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248370] SGN-U562669 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64433 [Download][View] Facility Assigned ID: TBFAA50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0186 Quality Trim Threshold: 14.5