EST details — SGN-E324637

Search information 
Request: 324637Match: SGN-E324637
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C128854Clone name: cTOC-9-E16
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182958 is on microarray TOM1: SGN-S1-1-5.3.5.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182958 [TUS-40-O20] Trace: SGN-T187902 EST: SGN-E376008 Direction: 3' Facility: INRA
Clone: SGN-C182958 [TUS-40-O20] Trace: SGN-T187903 EST: SGN-E376009 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E324637Length: 527 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E324637 [] (trimmed) GGTTTATTCAAATCTGTTCTTTCTAATCTGGTTAAAAAAAGGCCAAGATTATCATTGTCATCATCAGAAGTTGAGTCTTCTGTTGTTGGTGGAGT
GTCCACAAAAGAGGAACACTGGAAAATTGCATTAGCTGAGGTTTCACATAAGCTTATTCAAGCTACTAGAAAAAGAGATGAGGCTGTTTTAGAAG
CATCAAGATTGAAGTTTTCTATGGTTGAGCTTGAGAAAAAGCTAAACAAACTTGAAATTTACTGTCATAATTTGAAGTCTGGTCTTGATGTTTGT
AGTAACAACAAAGTTATGATGACTAACAAATCCTCTTTAAGTTTGGTTCAAAGAGTGAAATTTGGTGAAGAGGATAAAGTAATTGAGCATTTCTT
AGTTATGGTGTCTGAGGCAAGATCATCTGTTAGGATATTAAGTCGATCGATGACTCTTCAACTTAAGCAGATTGGTAGCAAAGTATATGATCGAA
TTGCATTATTACTCCAACCATATGAAATCAAGATTTTAATATCAAGAAACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E324637] SGN-U565946 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T137646 [Download][View] Facility Assigned ID: TFCBH32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5