EST details — SGN-E325471

Search information 
Request: 325471Match: SGN-E325471
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C125569Clone name: cTOC-1-F8
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182252 is on microarray TOM1: SGN-S1-1-7.2.8.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182252 [TUS-39-B10] Trace: SGN-T191526 EST: SGN-E390200 Direction: 5' Facility: INRA
Clone: SGN-C182252 [TUS-39-B10] Trace: SGN-T191750 EST: SGN-E390424 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E325471Length: 384 bp (808 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E325471 [] (trimmed) GATTATGGTTACAAAGGTCAGGGAAAGTTGTCGTTTGTGAGCATCAGAGTTTGGAAAGGGTATCACCATTGATTGAGATCTTGAGATTGAGGAAG
CAATGCCCTTCAAGGAAACAATGTAGTGGGCAGGGGCCAGCTGAATACAAAGAAGCTAAACCAGCAGGAAACATTGCAGGTACTAAATCTACAGC
AGATGTCAATGAGGAGAAAGCTATTGTTCTTTACAAGCCGGGGGAAGATCAACCTCAAACAGATTTGCAGGAAGAAAATTCAAGAGTACAGTTTC
TGAAGGTCCTGGAGACTCGCAAGTCTGTGCTTCAAAAAGAACAAGGAATGGCATTTGCTCGTGCTGTAGCTGCTGGTTTTGATATTGATCGTATG
ACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E325471] SGN-U567343 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136209 [Download][View] Facility Assigned ID: TFCAD28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0144 Quality Trim Threshold: 20.5