Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E336412

Search information 
Request: 336412Match: SGN-E336412
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C138520Clone name: cTOE-4-I3
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: Alias clone SGN-C184568 is on microarray TOM1: SGN-S1-1-3.2.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184568 [TUS-45-B22] Trace: SGN-T198775 EST: SGN-E397449 Direction: 3' Facility: INRA
Clone: SGN-C184568 [TUS-45-B22] Trace: SGN-T198776 EST: SGN-E397450 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E336412Length: 493 bp (1021 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E336412 [] (trimmed) GCACATCTTCAGCTCCACCACTACTTTTCCGATCACCGGAGCTACCACCGGAGTAAACACCACCATGTCAGTCAAGGAGTGCACTCACCACAAAG
ACAAAAAACGAAAACGCGTCCGACGACTCTTCGCCGGAATCCTAATTTTCCTCTTCGTCGTCCTGTTAACCATCTTACTAGTCTGGGCAATTCTA
CAACCGAAAAAACCCAGATTCATTCTCCAAGACGCCACCATCTTCAATTTCAACGTCTCTGCTCCGAATATCTTCTCCACATCGATTCAAGTCAC
TATATTTGCCCGGAACCCTAACGATAAAGTCGGGGTTTACTACGATAAGATGAAAACATACGCAAACTATCACAATCAACAAATTACATATTATA
CCCAAATTCCTTCAGTTTATCAAGGTCATAAAGACGTTAACATATGGTCGCCGTTCGTTTTCAGTAACAATGTTCCGATTTCACCTTATAATGGA
CCAGATCTGAAGGAAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E336412] SGN-U566668 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T148070 [Download][View] Facility Assigned ID: TAIAM50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5