EST details — SGN-C34311

Search information 
Request: 34311Match: SGN-C34311
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34311Clone name: cLEG-30-H3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177210 is on microarray TOM1: SGN-S1-1-1.4.8.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177210 [TUS-25-P8] Trace: SGN-T182171 EST: SGN-E369682 Direction: 3' Facility: INRA
Clone: SGN-C177210 [TUS-25-P8] Trace: SGN-T182172 EST: SGN-E369683 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255373Length: 540 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255373 [] (trimmed) TTTTTTGTCAATTTTCTTCAGCTTTTAATAAAAGTGAATCATTGGGGGTCTTTGGGGGTTGTCCCAAACTTGCATACTACAGCTCCAGCTTTGAA
ATGCATCCTAAATAGAACTGAAGACCTTTAAGTTTTACAGTTCACTCATTAAGAGGAAAAGATCATCACTTGGGAAAATGTACCAAAATCACTAA
TACAACTTTATTTTTTTTTCCCCAATGAATTTTGCTCAGATTAATAAGAGGAAACAAGAAAGGGAGGGTACAACCAAATCAGTAATTCTGGGAAA
ACCTTTCACATCCAAAGCACAACCTATGCTTTGTGACTTTTTGCCATCTCATCAACATCCAGTTCTACTTCTAGGACTGGTGAATCCAAATCCAT
GCTAAACGGACTGTTGTTAACAGGACCATGATCTACTGCCGTCCTCAGGCAATATATAGCTCTGCCAACTATGTCTTTTAAGGAAACAGGGCCAA
AAGTTCTGCTATCTTTGGCTTCCTTAGGTTTCACATTTTCATTATCAGCCAGCACCCAACATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255373] SGN-U578535 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69099 [Download][View] Facility Assigned ID: TBFEO38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5