EST details — SGN-C34331

Search information 
Request: 34331Match: SGN-C34331
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C34331Clone name: cLEG-30-I5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183549 is on microarray TOM1: SGN-S1-1-6.4.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183549 [TUS-42-H11] Trace: SGN-T196086 EST: SGN-E394760 Direction: 5' Facility: INRA
Clone: SGN-C183549 [TUS-42-H11] Trace: SGN-T196198 EST: SGN-E394872 Direction: 3' Facility: INRA
Clone: SGN-C183549 [TUS-42-H11] Trace: SGN-T196198 EST: SGN-E399378 Direction: 3' Facility: INRA
Clone: SGN-C183549 [TUS-42-H11] Trace: SGN-T200360 EST: SGN-E399379 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255301Length: 548 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255301 [] (trimmed) CAAGCAACTCCTTTAAGCATCGGCATTCAGGCTGATGGAGGTGACTTTGTACCAGTTATTCATCAGAACACCACAACACCGGTAAGGAAAGAACA
GATCTTCACTACCGTCCATGATGACCAAGCTGAAGCATTGATCCTGGTTTACGAAGGCGATGAGAAAGCCGCGGAACACAATCATCTCCTAGGCT
ATTTTAAGATCAGAGGAATACCTCCAGCACAAAAAGGTGTTCCTGAGATTAGTGTGTGCATGGACATTGATGCTTCTAATGTCCTGAGAGTCTTT
GCTGGCGTAATCGTGCACGGGACTCAGCGTGCTCCTATGCCTTTCATGGAAGTAAGGATGCCTACTGTTGATGATGGACATGGCTGGTCTGCTCA
AGCTCTGCATAAAATGTATGGATCCACTTTAGATTTGGTTACAGTAAAGAAAATACAGCATCGAGATTGCTGAATACATAATAAAGTTATAAGAG
ACATATTAGGTGTTGTTAGTAGTGAAAAATGTGGCAACTATTTCATGTAAATATGTGTCCTGTTTTATATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255301] SGN-U580434 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69027 [Download][View] Facility Assigned ID: TBFEM51THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0038 Quality Trim Threshold: 12.5