EST details — SGN-E359397

Search information 
Request: 359397Match: SGN-E359397
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102752Clone name: cLHT-31-I5
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194113 [TUS-69-P15] Trace: SGN-T347426 EST: SGN-E546551 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194113 [TUS-69-P15] Trace: SGN-T347427 EST: SGN-E546552 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359397Length: 454 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359397 [] (trimmed) TAATTTGGTCGAAGCGGAACAAGTTCAACGGTCTTGTCTTCTTAAACAAGAACTTCTTTTTTCTCTCTGTATATGAAGTATCTACTCTCTCACTG
TATCCCATTAAAGAGATCATGGAGGAACTTGATCTTATCAAACAAGAAACTATGGATGAACTTGATGAAAGCCTTAATCAACATGAGAATGAGGT
AGTACCTGAGGACTTACTCCTTGAGGTGAAAGAAGAATCATCACTCCTTGAGGTGAACCAAGACCAATACCAAGACCAATACCAAGACCAAGAGG
AAGACCAAGACCAAGAGCCTGAGCTAGAGCAAGAGCGAGAGCAAGAGCAAGAGCAAGAGCAGGAGCAGGAGCAACATCAAGATCAAGATCAAGAT
CAAGAACAGGAACAAGTGCAGGAACAAAAACAAGAACAAGAAGGTGTTGCTGCTACTGGAGGTGTTGGTGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359397] SGN-U590026 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171783 [Download][View] Facility Assigned ID: THTEQ51THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0274 Quality Trim Threshold: 14.5