EST details — SGN-E362541

Search information 
Request: 362541Match: SGN-E362541
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106127Clone name: cLPP-1-O7
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194260 [TUS-70-F18] Trace: SGN-T347678 EST: SGN-E546803 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362541Length: 334 bp (1041 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362541 [] (trimmed) GATCTCAATTCTTGATGATCCTAGTATTAGTAGAGTCATGAGGGAAGCTGGTTTTTCTAGTACACAAGTGAAAAACAATGTAGAACAAGTTGTTT
CTAGTATGGAGATAATTACTAGCACAAAGCCATTAGTACTAGGAAACACAAACACCAATACCAACACACAAATAACATCATCAACTAGTCATCAT
CATCATGTTCTAAATTTGTCACTTAGTAAAACAGGACAACATCAAGTTGTAAAGAATGATGATGTTATGAGTGTTGTGGAAAGTATGATGAATTT
CAAGAAAAGGAGAAACATTGTTGTTATTGGTGAGTGTTTAGCCACAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362541] SGN-U601418 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174602 [Download][View] Facility Assigned ID: TPOAA88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0023 Quality Trim Threshold: 20.5