EST details — SGN-E367856

Search information 
Request: 367856Match: SGN-E367856
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175999Clone name: TUS-22-M21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175999 is on microarray TOM1 spot ID 1-1-4.1.11.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C18653 [cLED-24-D11] Trace: SGN-T54862 EST: SGN-E240965 Direction: 5' Facility: TIGR
Clone: SGN-C175999 [TUS-22-M21] Trace: SGN-T180471 EST: SGN-E367857 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367856Length: 568 bp (891 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E367856 [] (trimmed) AATTGAAACTCATTTTTTCGATTTTATTCATGATGAAATAATACCGTTACAACACTCAAATACAACAATAAAGGAAAAAGATACCGAAAATCAGA
AATAGTGAAGAGAGAAGAGAGAAAGCCAACCCCAAATATTAGAACTGAAAACATAGTTGGTTCATTGAACAAGACAAAGAAAAATCATGTAAAAA
TTGGATCTTTTCTCTAAATCTTCAAGCTACTGGTGTCTTCCTATTTGGCTTGAAGACATTCTCAATGAGGGACTCCTTGATGGACTTCATTTCAG
GGAATTCCTTGCTCAATTTTGAAGCATCGAGCTCATTGTTGCTTCGTGGAGCGATAATGACCTCCGATTGCTCCTCGATTGTGAAGTTGTTCCAC
TTGAAGCTTGGGTCAATATAGTCACGGTACATCTCCAGGATCTCGTTATGGCTAACCACTCCAGGATTCGTGAAGTTCCATATGCCAGTGAGGTT
TCTCTTTGCCATCTCGATGGAAATAGGGAGAAGTTCATCCAAGATTGTCATTGAGTTTGGGATGTTTACTACCCTCGCGTATCGAGTGATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367856] SGN-U574142 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180470 [Download][View] Facility Assigned ID: FA0AAD10AG11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5