EST details — SGN-E368094

Search information 
Request: 368094Match: SGN-E368094
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175938Clone name: TUS-22-K8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175938 is on microarray TOM1 spot ID 1-1-1.3.11.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17435 [cLED-19-K24] Trace: SGN-T53424 EST: SGN-E237510 Direction: 5' Facility: TIGR
Clone: SGN-C175938 [TUS-22-K8] Trace: SGN-T180574 EST: SGN-E368095 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368094Length: 611 bp (923 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368094 [] (trimmed) AACCTTAATGAATTTAAATAATATTACATATATATATATAAATATAATAAAGTACTTAATAACAAACATAGTCTTGATTACAAAAAAAAAAATGT
TAAAAATAGTATTTCATAGTTAGATCAAAGTGGCTTCAATCAATCTCGAAACCAACTAAAAAAAACCAAAAACTTGGTTATCTAATAGTAGTATA
TCAAAGCAATAGGCCTATAATCATCAGGGCAGTCTGGTGTACTAAGCTCTCTGTGACAGTCCTTTTGCTTTCCACAGCTCGAACCTGTTACCTCC
TGGTCCACATAACACTAACTTTTACCAGTTACGTCACACCAAGACTTCCCTTCTTCAATAATCAAAAATGAAAACAAAACAAAAAAAAAACAAGA
ATAGTAACTAGAAATATTGCTCAGTTTTAACAAATTGAGCACCTAATCCCAACCATGCTTTGTTATCCTCATTCTTGGATTTCTTGTTGTTGGAG
ATTTGGTATGGTGCAATTGATGTTACTCTATCTTTCCTTTTCTCCAAGAATCTTGTAAGTGAATTCCGTCTCGCGATTGGTAAATCAGCAACAGA
AGGCTGTGGCATTGACAGTTTAGGAAGTTCTTGAATCAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368094] SGN-U591506 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180573 [Download][View] Facility Assigned ID: FA0AAD10BF04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5