EST details — SGN-E368280

Search information 
Request: 368280Match: SGN-E368280
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177330Clone name: TUS-26-E8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177330 is on microarray TOM1 spot ID 1-1-1.1.7.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37214 [cLEG-41-G18] Trace: SGN-T72098 EST: SGN-E259066 Direction: 5' Facility: TIGR
Clone: SGN-C177330 [TUS-26-E8] Trace: SGN-T182414 EST: SGN-E368281 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368280Length: 502 bp (982 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368280 [] (trimmed) ACATAACTGTGGCACATCTATTGAAAACAAATATATTGGTTTGGTTTGTTACATACATACAAACTGTGTATATATTGTTGATACATTGCAAATAA
CAAACACTTGTTCAACCTCTAGATTCAAGACCAGGCTGAGTTCAACATTCGCGGTGCGCTCATCTCCTGTTTCTTCAAACTTGTCTGAGCCAGAA
TCCCCCACATTATGAAAAAATGAATCTATAGACAACACAAAAGACTGGGGTTGATAAGATCAACAAATTATGGTTTCCAAGCAGCTGGCGGAGGT
GGTGGAGTAGGGAACATGGGTGGTACTGCAGAGAATATCGTGTTCTTGTCAATTCCAACACTTTTATCTCCAGATAGAGCTACGAGGGCTGCAAC
CAACCCAGCATTTCCGGCAAGTGTTGGTTCGGTATTAATTGTAATTAGTACGAACATCATGGAAACCATTATTCTTGTTTGGTCCAGCATCCATG
GCACCAACAAGAATATTTGGGATTAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368280] SGN-U571690 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182413 [Download][View] Facility Assigned ID: FA0AAD14BC04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5