Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E368309

Search information 
Request: 368309Match: SGN-E368309
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177480Clone name: TUS-26-K14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177480 is on microarray TOM1 spot ID 1-1-3.3.6.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37523 [cLEG-42-F17] Trace: SGN-T72295 EST: SGN-E259534 Direction: 5' Facility: TIGR
Clone: SGN-C177480 [TUS-26-K14] Trace: SGN-T182441 EST: SGN-E368308 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368309Length: 625 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E368309 [] (trimmed) TTTAAAGGTGAGAATCTACTTGAGATGGAACCCGAGGAAAGATCTCTTGCTGGTCTTTTCATGAGCTTCCAGTCCCCAGTTGCCATACCTGGAGT
AAGCAATATTGACTTTCTTAACATGGCGTATAATGCTCAAAGGAGGAAACTTGGACTGCCAGAACTGGGACCAATTGAGTTTTACGGGTACATTG
CCCCGAAGCTTGAACTTGTCAACATGAAGATAGACTTCTTGAACAGAAATGTAAATGAAGGATTCAGTGGTGGAGAAAGGAAACGCAATGAGATT
CTGCAACTAGCGGTTCTCGGGGCTGACTTGGCAATACTGGATGAGATTGATTCTGGTTTAGATGTTGACGCACTTCGAGACGTAGCAAAGGCAGT
AAATGGACTTCTATCGCCAAAGAATTCAGTGTTGATGATTACTCATTACTTACGATTATTAGAATTCATCAAGCCGACGTATATCCATATCATGG
AGAAAGGGAGAATCGTGAAGACTGGAGACATATCCATAGCTAAAGTTCTGGAGAAAGAAGGGTACAAAGCAATTTCTGGCCCATAGAGCTGCCAT
GAAGAATGATGATTTTGTCTTATCAGCTAGCTACTAGAGGAAATATTTCTACTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368309] SGN-U582143 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182442 [Download][View] Facility Assigned ID: FA0AAD14BF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5