EST details — SGN-C36871

Search information 
Request: 36871Match: SGN-C36871
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C36871Clone name: cLEG-40-D14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185170 is on microarray TOM1: SGN-S1-1-1.3.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185170 [TUS-46-K24] Trace: SGN-T200105 EST: SGN-E398779 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256871Length: 378 bp (826 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E256871 [] (trimmed) AAGCAAAAAATTAAACAATTCTCGCTGAGATGCAAATGACCAGTAACTTACACCAACATCATCTCATAATCTTTACAAGAAGAATGTATAGCTTA
TAAATACCAAGCTGAATGCTAAACATCTTCGCAAAGCAATAAGGATCTGATCTTATAAACCCTGTAAAATTTACCTGATCAAATTGACTTAGACC
ATGGGGAACTGCTGTAAGACTATCACTCAGATAAAAAATCTGCCGTTGTGTTGTCAAGCCCCCCTGATCCATTTACTACTGGCAAGCTGACATAC
TGGGGACATGACCCAGAAGAGACTCTACCACTTTTGATGATAGAACCACTTGCACAATCACGAGGCTGTAAATCCTTATAGAAGCATATTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256871] SGN-U578216 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71840 [Download][View] Facility Assigned ID: TBFGD19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5