EST details — SGN-E369187

Search information 
Request: 369187Match: SGN-E369187
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176284Clone name: TUS-23-I18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176284 is on microarray TOM1 spot ID 1-1-7.1.10.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26352 [cLEF-40-B6] Trace: SGN-T60172 EST: SGN-E246320 Direction: 5' Facility: TIGR
Clone: SGN-C176284 [TUS-23-I18] Trace: SGN-T181224 EST: SGN-E369186 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369187Length: 654 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E369187 [] (trimmed) GATTGTCCTGTCATCCTTTGATAGGTCTCCGCTGGCTGCACTTACTATCTTAAAGAAAATATGTGACCATCCACTACTACTAACAAAGAGGGCAG
CAGAAGAAGTTCTTGAAGAGATGGATTCAACCTCAAACCATGATGACCGTGCTGTGGCAGAGAGATTGGTTATGCAAATGGCAAATGTGTCTGAG
AAACTTGAAGAGGAAGTAGTATCACATGATGTTTCCTGCAAGATAACATTTATACTGGCTTTGTTGGACAATTTGATTCCCGGCGGGCACAATGT
GCTCATCTTTTCTCAAACACGCAAGATGCTTAATCACCTCCAAGACGCTTTAATATCCAATGGGTTCCAGTTCATGAGGATAGATGGAACCACCA
AAGCTACTGACAGATTGAAGATTGTTAATGAATTCCAAGAGGGTCATGGTGCTCCAATATTTCTTTTAACTTCTCAAGTTGGTGGTCTAGGTCTT
ACACTCACAAGAGCAGATCGAGTGATTGTTGTTGATCCAGCATGGAATCCAAGCATGGATAATCAAAGTGTTGACCGCGCCTACAGAATTGGGCA
GACCAAGGATGTTGTTGTATATAGACTGATGACTACTGGCACAGTTGAAGAGAAGATCTATAGGAAACAGGTATACAAAGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369187] SGN-U576298 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181225 [Download][View] Facility Assigned ID: FA0AAD11BE09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5