EST details — SGN-E369511

Search information 
Request: 369511Match: SGN-E369511
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176337Clone name: TUS-23-K23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176337 is on microarray TOM1 spot ID 1-1-2.3.10.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26498 [cLEF-40-J7] Trace: SGN-T60021 EST: SGN-E246169 Direction: 5' Facility: TIGR
Clone: SGN-C176337 [TUS-23-K23] Trace: SGN-T181084 EST: SGN-E369510 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369511Length: 661 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E369511 [] (trimmed) GGTGGTTCTTCAGCTTCTTCAACCAATACTGTCAGCACCTCCACAAATGCTACTCCTGGTGTATTTAGTTTTGGTGGTAACTCTTTGGCTTCCCC
AACAAATACTGTCAGCACCTCTACCAGTGCTACCACTGGCATATTTAATTTTGGTGCTAGTTCTTCCGTTCTGTCAACAAATACTGTCAGTACCT
CCACTAGTGCTGCCCCCGGCGTATTCATTTTTGGTGCTAGCTCCTCAGTTCCGTCAACAAATACTGTCAGTACCTCCACTAGTGCTGCCCCCGGC
GTATTCAGTTTTGGTGCTAGCTCCTCAGTTCTGTCAACAAATGCTGTCAATGCCTCCAGCACAGTCAGTCCTAGTCCATTTGCTTTTGGTGCCAG
CTCTACCTCCTCACAAACTTCCAGTGCTGCTGGAATTTTAGGTTCCAATTGGCAGGCCCCTAAGTCTCCTGGCTTTAGTTCCCCATTTAGTTCTG
CTACCCCTACTGCATTTGCATTTGGAGCATCTTCATCTTCTTTTACTCCTCCAGCCACCACTGCTGCTGTCTTTGGATCAGCACCCAGTACCCCT
ACTGGACCAGCCTTTCCATTTGGTTCAACATCTTTGACAAATCCGTCTACACAGTCCATATTTGGGAACTCTACTTCTCCTTTTACTGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369511] SGN-U565301 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T181085 [Download][View] Facility Assigned ID: FA0AAD11AF12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5