EST details — SGN-E369877

Search information 
Request: 369877Match: SGN-E369877
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177407Clone name: TUS-26-H13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177407 is on microarray TOM1 spot ID 1-1-4.4.7.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37377 [cLEG-41-O11] Trace: SGN-T71895 EST: SGN-E258863 Direction: 5' Facility: TIGR
Clone: SGN-C177407 [TUS-26-H13] Trace: SGN-T182492 EST: SGN-E369878 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369877Length: 399 bp (944 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369877 [] (trimmed) AGAAGAAAGATGAAACTCAAATCACATACATATTAGTACTTAGCTGTACATCTGTTTCTTAGAGTACTGCATATATGTTGCAGCTTCATGCAGTT
TTAAAGACAAAAGGTAGTCAACAATGCATAACAGTTTTCTTATGATCACACCCTATTACATTATATATATATCAGCTTAACGCTCGACTGGAATC
TCATTTCAACACTAATCTGTGACTCAGTTGAGCCCTGAGAGATGACAAGTTGAGAACTGGCCTGTTACGTGCTTTGTCCTTCTTAATCTGGATTA
GCTGGTCATAAACACACCAGGGAAAGCTAATGAAATGAGCTCTTTTCAACCCCTGATTGTAGCAACCCCAATATGTAGGATGATATGTAACGTGG
TACCAAGCCCGAGCCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369877] SGN-U577143 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182491 [Download][View] Facility Assigned ID: FA0AAD14CD07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5