EST details — SGN-E369953

Search information 
Request: 369953Match: SGN-E369953
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177401Clone name: TUS-26-H7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177401 is on microarray TOM1 spot ID 1-1-2.4.7.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37364 [cLEG-41-N2] Trace: SGN-T72183 EST: SGN-E259151 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369953Length: 159 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E369953 [] (trimmed) GCACCGGGCAACGGCTGACTCCGCTACTCCATTCAAGAAAGTTCAGATTCAAAGGGATGATACTACATTTGATGCCTATGTAATTGGAAAAGACG
ATGCCCCTGGAATTGTTGTGCTTCAGGAGTGGTGGGGTGTTGATTCCCGCTTATACTGGCCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369953] SGN-U578584 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182567 [Download][View] Facility Assigned ID: FA0AAD14CD04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5