EST details — SGN-E369990

Search information 
Request: 369990Match: SGN-E369990
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177551Clone name: TUS-26-N13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177551 is on microarray TOM1 spot ID 1-1-4.2.6.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37663 [cLEG-42-L8] Trace: SGN-T72348 EST: SGN-E259587 Direction: 5' Facility: TIGR
Clone: SGN-C177551 [TUS-26-N13] Trace: SGN-T182605 EST: SGN-E369991 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E369990Length: 299 bp (1047 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E369990 [] (trimmed) AAGAAGAGAAAGAACTTTATAAACATATGCTCATGCAAAATTTCTTACAAGAAAATAGAGAACGAAAAATAAATAACTAGTACTGTTACATATAT
AGAGAAAGAACTATTACAGTAAAAAAAATGATCATAAGAACTTAACAAGATGGAAATGAAGACAGAAATGAATCCACATTTGGACATGGTAAAAA
CTTACTAACACCTAGACGCGACTGACCATGGTTAACTGATTTAACGAGGTGAATATATATGTTAACCATAGTTAAAGCGAGGAAAGTCGATGTGC
AAACACATGTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E369990] SGN-U574659 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182604 [Download][View] Facility Assigned ID: FA0AAD14CG07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.897 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5