EST details — SGN-E370020

Search information 
Request: 370020Match: SGN-E370020
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177314Clone name: TUS-26-D16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177314 is on microarray TOM1 spot ID 1-1-1.4.7.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37162 [cLEG-41-D6] Trace: SGN-T72153 EST: SGN-E259121 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370020Length: 301 bp (931 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E370020 [] (trimmed) TTCATTAACCTTATCTGTCTTCACTCCGGCGAACGGCGATGTCTCACTTCGGTAGATCAGGCCCACCGGACATCAAAGACACCTACTCTCTGCTC
GTTCTCAACGTTACTTTTCGTACCACTGCTGATGACTTGTTTCCTCTATTTGATAAGTATGGAAAAGTAGTCGATGTCTTTATCCCTAGAGACCG
AAGGACTGGAGATTCTAGGGGTTTTGCATTTGTGCGCTACAAGCATCACGATGAGGCTCAAAAAGCATGGGAAAAGCTTGATGGAAGAGTTGAAC
TATGGTCTGTACATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370020] SGN-U581471 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182634 [Download][View] Facility Assigned ID: FA0AAD14DB08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5