EST details — SGN-E370475
| Search information |
| Request: 370475 | Match: SGN-E370475 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C178393 | Clone name: TUS-29-A15 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C178393 is on microarray TOM1 spot ID 1-1-2.1.4.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C65294 [cLEM-8-O15] | Trace: SGN-T85504 | EST: SGN-E271953 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C178393 [TUS-29-A15] | Trace: SGN-T183817 | EST: SGN-E370476 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E370475 | Length: 163 bp (981 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E370475 [] (trimmed)
AAACTAAGTACGACTTTTACTGCCTTATTCCATTTTTTAATTATGTTGCAATATGCATAAGTAGCTGATGTTATACATAGCAATGGAAGTAAAAT
ATAGGATGAGGTGATCAAGATATGGATGTTGCTGCAAAAAACAGCTCCAACTGTTTACATGAAAAATG
ATAGGATGAGGTGATCAAGATATGGATGTTGCTGCAAAAAACAGCTCCAACTGTTTACATGAAAAATG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E370475] | SGN-U574948 | Tomato 200607 | Build 2 | 18 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T183816 [Download][View] | Facility Assigned ID: FA0AAD17AA08FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.880 | Expected Error Rate: 0.0045 | Quality Trim Threshold: 14.5 |


