EST details — SGN-E370479

Search information 
Request: 370479Match: SGN-E370479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178431Clone name: TUS-29-C5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178431 is on microarray TOM1 spot ID 1-1-4.3.4.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72058 [cLER-1-A21] Trace: SGN-T91814 EST: SGN-E280260 Direction: 5' Facility: TIGR
Clone: SGN-C72058 [cLER-1-A21] Trace: SGN-T91815 EST: SGN-E280261 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370479Length: 147 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E370479 [] (trimmed) GCCTCGTGCCGCCCATCTCGCAAAACACCCTTATCCCTCAAATCTTCACTCACTTCTCACCAATCCACTTCAAAACCCCTTTCTGATTCTCATCT
AGTTGCGGATGATAAATTGTCCTTGCTACTTGCCTCTGCTCCTCAGTCCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370479] SGN-U571200 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183820 [Download][View] Facility Assigned ID: FA0AAD17AB03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.892 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5