EST details — SGN-E370548

Search information 
Request: 370548Match: SGN-E370548
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177672Clone name: TUS-27-C14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177672 is on microarray TOM1 spot ID 1-1-3.3.6.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C47489 [cLEI-16-G23] Trace: SGN-T83341 EST: SGN-E269117 Direction: 5' Facility: TIGR
Clone: SGN-C177672 [TUS-27-C14] Trace: SGN-T1457 EST: SGN-E378535 Direction: 5' Facility: Giov. Lab
Clone: SGN-C177672 [TUS-27-C14] Trace: SGN-T182924 EST: SGN-E370549 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370548Length: 360 bp (884 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370548 [] (trimmed) ATAATATAAATATTTTTTATTTATAATATATTTACTTAAGTTTCCTATAAAATAACATATATACATTTTGTTTGAGTAAATGTCATTTAAGTAAA
ACTACACAAACAAATATAATTAAAATTAAACATTCAGAGCCAATTTACATAATCAAAAAAATAATTAACAAATCCAATTGCCAAATATTTACACC
CATAGTTTATTCCTTTCTCCTCCTTCCTATTTTTCATGATTTTTTTTTCTAATATGTACCAAAACTCCAACTATACAATAACATACATAAATTTT
AAAAAATAAATTAAACACTTTTATTTTCAAAATATCTTTCAACTTAACCCGATCCATATTACTTCCCTTGACTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370548] SGN-U568241 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182923 [Download][View] Facility Assigned ID: FA0AAD15BB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.812 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5