EST details — SGN-E370999

Search information 
Request: 370999Match: SGN-E370999
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178603Clone name: TUS-29-J9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178603 is on microarray TOM1 spot ID 1-1-8.2.4.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72264 [cLER-1-K21] Trace: SGN-T91869 EST: SGN-E280315 Direction: 5' Facility: TIGR
Clone: SGN-C72264 [cLER-1-K21] Trace: SGN-T91870 EST: SGN-E280316 Direction: 3' Facility: TIGR
Clone: SGN-C178603 [TUS-29-J9] Trace: SGN-T1504 EST: SGN-E378694 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178603 [TUS-29-J9] Trace: SGN-T184069 EST: SGN-E371000 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370999Length: 283 bp (897 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E370999 [] (trimmed) GGTTGATTCAGCTATATGTTATTGATCCATGCCCTCAAAATTCAACTTTTTAGAGGGACAAATGCCAATACACCGATTCATTAAAAGATACACAT
AGATTTAAAAAGGGAAGTCCCAAAAAATGAAATTAAAATTTCAAAGGAAAAATTTACCTATCTACATGGATGCAGGGGGAGAGAAGCATAATGTT
GGCTCATATTTGTACAAAGAAAAGTAAAAATATTTAGTAAACTTCAACATTCCATTGCTCTGCCTTCTTCAATTGCTTCTTGTAGTCCGCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370999] SGN-U581081 Tomato 200607 Build 2 156 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184068 [Download][View] Facility Assigned ID: FA0AAD17CE05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5