Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E371050

Search information 
Request: 371050Match: SGN-E371050
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178509Clone name: TUS-29-F11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178509 is on microarray TOM1 spot ID 1-1-6.2.4.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72145 [cLER-1-E5] Trace: SGN-T91832 EST: SGN-E280278 Direction: 5' Facility: TIGR
Clone: SGN-C72145 [cLER-1-E5] Trace: SGN-T91833 EST: SGN-E280279 Direction: 3' Facility: TIGR
Clone: SGN-C178509 [TUS-29-F11] Trace: SGN-T184120 EST: SGN-E371051 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371050Length: 278 bp (892 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371050 [] (trimmed) AAGCAAAAAACAGCAACATGTAGATTGAAGTATTCCGGTTATACTTTCACTAAAAACAGTAAGAACAAGGTAGAAATTAGAGGCATCAACAAGTT
TTTAAGAGGCAACATAGAGTTATTATGGCTTGTAGTACTTGGTGGGTACAAAAGGCATCTTGGTAACCACCCCATCATAAGACTTTCCTCGAATC
ACAATCTTGACATTAGTCCCTGTCTTGTGGTTACCCGTTTTTACGTATCCCATTGCTATGTTCTTCTTCAGACAAGGGCTGAAACCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371050] SGN-U579550 Tomato 200607 Build 2 99 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184119 [Download][View] Facility Assigned ID: FA0AAD17CC06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0010 Quality Trim Threshold: 12.5