EST details — SGN-E371054

Search information 
Request: 371054Match: SGN-E371054
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178547Clone name: TUS-29-H1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178547 is on microarray TOM1 spot ID 1-1-8.4.4.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72190 [cLER-1-G8] Trace: SGN-T92105 EST: SGN-E280551 Direction: 5' Facility: TIGR
Clone: SGN-C178547 [TUS-29-H1] Trace: SGN-T184124 EST: SGN-E371055 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371054Length: 501 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371054 [] (trimmed) AAAAACTTAAATTGTGTCTGAATTTTCCTTCAAAAATGGTATATAAAGGCTCAAGGAGTTGAAGTATGAACTCAACAGATTTGACAAAACTTTTA
ATCCATCTAGTCAAAAAGAGAGGAGATAAACAAATAACTAATGAAATACAAAATGAGGGCCTCTTTGCCTAGAGCAAATATCAAGTACACAATTG
ACCATCCTCAAAAGGCAAAATCTTTCTTTCAACATACTACTACCTTGGGGGGAAAAAAAAATACAACTCACTTAAAAATCAACCTGCTCTCGACC
ATCCTGCGGTTCAGTTGCTCTTCACTCCATTGGACATCAACAAGAAATGCTGAAAAGTAGTTTTGAGTATATTCCATCTACTGAGGGTACAAAAA
ATCGATCTTTCTCAAAGAGTTGATCGAGCTTTTTATTGAAAGAAAGCTTTGCATGCCTCAACATCGGACGATTGAGAATTCAACACTGCTTGGCC
TGTAGGACTAGAGCTAATAGATCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371054] SGN-U584444 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184123 [Download][View] Facility Assigned ID: FA0AAD17CD01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5