EST details — SGN-E371374
| Search information |
| Request: 371374 | Match: SGN-E371374 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C177863 | Clone name: TUS-27-K13 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C177863 is on microarray TOM1 spot ID 1-1-4.3.6.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C64154 [cLEM-5-E22] | Trace: SGN-T85026 | EST: SGN-E271221 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C177863 [TUS-27-K13] | Trace: SGN-T182883 | EST: SGN-E371375 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E371374 | Length: 142 bp (950 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E371374 [] (trimmed)
AAAACCGCCAAAACTTTGGCGTTATAACCTTCATTTCAAGCTATTTCACACTTTTTCAATATTCTCTACCCATTACACGTCCTTTAAAAAACGAA
ACAGAGGCATAGGTTCCAAAATTGGGAAACATTGATGGGGGGAAAAA
ACAGAGGCATAGGTTCCAAAATTGGGAAACATTGATGGGGGGAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E371374] | SGN-U571391 | Tomato 200607 | Build 2 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T182882 [Download][View] | Facility Assigned ID: FA0AAD15AF07FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.848 | Expected Error Rate: 0.0285 | Quality Trim Threshold: 14.5 |


