Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E371427

Search information 
Request: 371427Match: SGN-E371427
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178514Clone name: TUS-29-F16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178514 is on microarray TOM1 spot ID 1-1-1.2.4.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72149 [cLER-1-E9] Trace: SGN-T91835 EST: SGN-E280281 Direction: 5' Facility: TIGR
Clone: SGN-C72149 [cLER-1-E9] Trace: SGN-T91836 EST: SGN-E280282 Direction: 3' Facility: TIGR
Clone: SGN-C178514 [TUS-29-F16] Trace: SGN-T1495 EST: SGN-E378394 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178514 [TUS-29-F16] Trace: SGN-T184193 EST: SGN-E371426 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371427Length: 693 bp (930 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E371427 [] (trimmed) TTTTTTTTCGCATACAAGATAAGCAAAGCCCCTGAATCGAAGACTGTTATTTAAAGTAAGTGTCTTCCCCAGCCAAGAAAATGGCTTAATTCAGT
TTTAGAAACATAGAGATTCACATGCATTGGAAGTCATATGACATATCTTCCCTCACTTTTTAACATTTCTCTACAAATCATAAAGCTCATTGCAA
TAGAGAAGTTATCAACTAGTTGATAACAGAAAGAGTTGGCAATAACAGATAGAAGGCCAACTAATAACAAAGCCTTCATGCTGATGAGAACAGCA
GTCGGCTTAGTAGTGTTGTGACCAGTTAGCAGCACTACCCACTCTGGGCATGCCTGAATCCACTTTCTTAGACTCTGGGTCCACCTTAAAATTTG
CTCCACACACCTCGCCTGAGCTGTCCACCCTCGGTACTGATTTCAACTCATTGCGTGCTCGAGTTTTTTTTTTTTTTTTTTATAATCAAAATGAC
GATATTTTATATTTATTCTCCCAAAAGGGTTTTTTATTGCACACACCAGACAACTGAATATTATAGTAACAGAAAAGCCAAAAACCACACCACAG
AACTGAATTAAAAGACCAAAAACCAATATTACTACTATAGTATAGCATACTAAAAAGGAGAATTAGACATTTATCACTAACATATCTTCTCCATT
TCCTCATCCTCGTTCTCACTCCAACAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371427] SGN-U577782 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184194 [Download][View] Facility Assigned ID: FA0AAD17DC08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5