EST details — SGN-E371457

Search information 
Request: 371457Match: SGN-E371457
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C178666Clone name: TUS-29-L24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178666 is on microarray TOM1 spot ID 1-1-1.4.3.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72343 [cLER-1-O15] Trace: SGN-T92080 EST: SGN-E280526 Direction: 5' Facility: TIGR
Clone: SGN-C72343 [cLER-1-O15] Trace: SGN-T92081 EST: SGN-E280527 Direction: 3' Facility: TIGR
Clone: SGN-C178666 [TUS-29-L24] Trace: SGN-T184225 EST: SGN-E371458 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E371457Length: 525 bp (830 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E371457 [] (trimmed) CAGCAGTAAATAAAGTTTCTATTGACAAATTGACAGAATTTGTTTAGATGAATAAGGATGTATCAATATCACTCTTTCAATACATAAACAAGAAG
AGAAAAGGAAATAATCAGTTCTTTGAAGCAGACTGGAAGATGAAGACAGCGGTCAAAACGCCCACCAATGCAGTGACTGCCAATGCTACTGTAGG
TATGGGCCCTGAGACCCCGAAATTCTCCAGAAGTCCTTTGCCTGTAGCTATTTCTACACTAATAGCAGCTGCAAAACCAACCATGGCAGATCGAC
CAAGCCATACATCCAAATTACTTCCGTCCTTGGTACTCTGCTCACATCGTACAGAAAGTGATGCTGCCCTACTTGGCGTAGCTTTTATCTGAGAG
AAACTGTTCCTGATCAAGAGTGGAGAACCAGTTGCAAAAGTAGTCCCAAATTGAGTACGAGTAGAGCCCTTAATAGAAGAAATGGATACTGGGTT
TGACACTACAACATCACGAATTGAAGTGCAGAGAGAACTGGAAATTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E371457] SGN-U576201 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T184224 [Download][View] Facility Assigned ID: FA0AAD17DF12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5