EST details — SGN-E372617

Search information 
Request: 372617Match: SGN-E372617
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179457Clone name: TUS-31-M23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179457 is on microarray TOM1 spot ID 1-1-2.1.2.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82272 [cLET-1-H11] Trace: SGN-T102470 EST: SGN-E292196 Direction: 5' Facility: TIGR
Clone: SGN-C179457 [TUS-31-M23] Trace: SGN-T185073 EST: SGN-E372616 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372617Length: 287 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E372617 [] (trimmed) TGGGTCTGCATCACAAGTCCAAACAGCACAACAATTAGTTCAGAATTCAATCGCTGATGCTACCAGCTCAATGCAGAACACTGCAGCTGGACCAC
CTTCCCAAGGTTATAATCCCTACCCTTCTCAGGGTCCTGTGTACTCTTCATCCACTGGTCACGCTGGTCATGCGCCATCTGCAGATTATGGTTCT
GTTTATGGAGGTAGCTACGGTTATTAAAGGATATCCCGTTCAAACCAGCACTAGAACTACGAGTCTTCAGCTGTTGGGAAATTTTAGGAGAACTA
GT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372617] SGN-U564926 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185074 [Download][View] Facility Assigned ID: FA0AAD19AG12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5