EST details — SGN-E372733

Search information 
Request: 372733Match: SGN-E372733
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179626Clone name: TUS-32-D24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179626 is on microarray TOM1 spot ID 1-1-1.4.1.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80081 [cLET-11-D15] Trace: SGN-T105337 EST: SGN-E292874 Direction: 5' Facility: TIGR
Clone: SGN-C179626 [TUS-32-D24] Trace: SGN-T1540 EST: SGN-E378554 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179626 [TUS-32-D24] Trace: SGN-T186215 EST: SGN-E372734 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372733Length: 734 bp (833 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372733 [] (trimmed) AACCAATCCAATAATACTACATGATGTATTCTGTGGATTAACACAACCTTAAAATACAATCTTGGGAAGAAGTACAATGCAGTAAAATTGACAAT
GGCAAGGCATGTAGCTACTCATTGCAGCAACCATAAAAGAAGGGGGCATTCTTACACTGCCCTATTATGATTTTGCATAAAATGTGTTCTAATTG
GGGAGAAAACCAGGACATAGTTTACTACAAAATGTTCGAAAAGGATCATAATTCTAGCAATACAAAATTGTCCTGGACCTGGAGTCCATTCATGT
TTTCCAACGACTTGTCACTCCTTCCACATATCGGCAAATTCATCCACCTCCATAGGATTAGACAATTGATGTATCTTTCTCCTGGCCTTTGCTTT
GACTTTCTTTGCATATTTGCCAGCCTTCTGTTTTTTCTCTAGTGATCGGATCTGATTGGGTGCAACATAAAATGGGTTCTCATAAAGAGTAGGGC
CACCAAAGCTACCACCAAAGATCTTAATTGGGTTCAAGCAAAACCTTGGACCAACCTCAACAAGTGTCATCTTTTCCAGGTCCCCACGGTCTATT
TTCTGTGTTGCTCCATTATGAGGACAAGATATCTGGTAATTACGGAACCACACGTGGTCATCAAGAATTGAAAACACAATTACATGATCATAGAA
AGGTTTAGATTTCCGGTGATCCTTTGGGGTTCCAAAAATCTGTATGAACATTTTCTTCAAAAGCTTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372733] SGN-U574577 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186214 [Download][View] Facility Assigned ID: FA0AAD20DB12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5