EST details — SGN-E372788

Search information 
Request: 372788Match: SGN-E372788
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179864Clone name: TUS-32-N22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179864 is on microarray TOM1 spot ID 1-1-3.2.1.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86796 [cLET-44-F12] Trace: SGN-T111361 EST: SGN-E298725 Direction: 5' Facility: TIGR
Clone: SGN-C179864 [TUS-32-N22] Trace: SGN-T1563 EST: SGN-E378561 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179864 [TUS-32-N22] Trace: SGN-T186270 EST: SGN-E372789 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372788Length: 384 bp (841 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372788 [] (trimmed) AAAAACAAACTAGGGGTCCATTTATTTAACAAACATACTTAAAGTAACACAAGCCGGGGTAAAGGGCCACAACCCTATTACATACTTACATATTA
CATAGCAGTAGCAATTAATGGGCTTTTATTTCATACATAAAATACTTGCAAATTAAAAAATAGCAACATTGCTTTTCTGTAAATCATTTTCTCCC
TCACTTACCCATTCAAATTCTCCGTCACAAATATAAGTTCCATCAGCGCTGAAATATTTACATCCCTTTTTACCTGCACAACAGTTAGGGCATAG
TCCTTTAACTTTTTTAGTTTCTAAAAGGGGGCAAATCCCAAAGTCAATTCTAGTATCACATTTTTTTGGGCAATCCTTCTCGAAATTATTACCTG
CAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372788] SGN-U585601 Tomato 200607 Build 2 111 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186269 [Download][View] Facility Assigned ID: FA0AAD20DG11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.869 Expected Error Rate: 0.0080 Quality Trim Threshold: 12.5