EST details — SGN-E372939

Search information 
Request: 372939Match: SGN-E372939
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179843Clone name: TUS-32-N1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179843 is on microarray TOM1 spot ID 1-1-8.2.1.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C86724 [cLET-44-B12] Trace: SGN-T111353 EST: SGN-E298717 Direction: 5' Facility: TIGR
Clone: SGN-C179843 [TUS-32-N1] Trace: SGN-T1561 EST: SGN-E378702 Direction: 5' Facility: Giov. Lab
Clone: SGN-C179843 [TUS-32-N1] Trace: SGN-T186093 EST: SGN-E372940 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E372939Length: 667 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E372939 [] (trimmed) AACTAAATATTCGCGTCGGCTTTTCATTGATGTTTACACTATGTGAAACCAGGAAGATTAACACATCAGTACAATCATACATAAAATATGCCTTC
ATAGTTGCTGCTCAAGTTTTTGCCGTATTACTAAATTTAAGTGTAAAATTCACATACTTTTGCTTTGACTCAAGCCCGAGTCACGGGGATATAGT
TTATTTTATTTCGCTGAAACATTATCTCGAAATACACCTAGAGACAATTGGGAAAGCAGCATCTTTGAAATTCAAGATACAAAATTCTGTCAAAG
CAAGTTACACAGATAAAATGAAGCACAAAGTAACAACCTTTTCATGAAGATTTGATGGAATCCACAAAGCCACTACTAAAAAGCCTCTCCACATA
CTTTCCCAATATATCCACCTCAAGATTAACCTTCTGCCCCACTTTCTTCAATGGAATCACCACATTCTGCTGCGTGTACGCCACCAACATGAAGT
TAAAACAGCCTTCTTCATCAACCACATCGACAACAGTCAAACTAGTCCCATCCACAGCAATGAATCCTTTTGGCACAATGTACCTCAAAATCTCT
TTAGCAGTCTTCACCTTCACCCACAAAGAATCCCCTTCAGTTTTGAGCTCAACAATCTCACCAGTCCCATCAACATGTCCCTGCACAAAATGACC
CC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E372939] SGN-U582211 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T186092 [Download][View] Facility Assigned ID: FA0AAD20CG01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5