EST details — SGN-E373051

Search information 
Request: 373051Match: SGN-E373051
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179553Clone name: TUS-32-A23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179553 is on microarray TOM1 spot ID 1-1-2.1.1.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82396 [cLET-1-M4] Trace: SGN-T102637 EST: SGN-E292363 Direction: 5' Facility: TIGR
Clone: SGN-C179553 [TUS-32-A23] Trace: SGN-T185713 EST: SGN-E373050 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373051Length: 283 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373051 [] (trimmed) GAAATACTTCAGTCTAGAGGTACATTCACTTAGAGCTAATTCAGTACCTGCTATAGAAAGAACTTCTCCCAATCGACGTTTACAAAAGAAAGGGA
CTTCTCGTGTAAGGTTTGAACGTAGATTGTTTAGTATAGAACTTTTCATTTTCTTTGCCTTTTTTTCCTTGTCCCTTGCATATGGTTGAGATGTA
AAATTGGATAGCGGAATATACTTACGAGATAATTGTTCCATTACATTATCTGATGAAAAACAATGCAACGTAAAAGCAGATTGTTCGTCCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373051] SGN-U572252 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185714 [Download][View] Facility Assigned ID: FA0AAD20AA12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.888 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5