EST details — SGN-E373088

Search information 
Request: 373088Match: SGN-E373088
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179735Clone name: TUS-32-I13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179735 is on microarray TOM1 spot ID 1-1-4.1.1.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80330 [cLET-11-O18] Trace: SGN-T105329 EST: SGN-E292866 Direction: 5' Facility: TIGR
Clone: SGN-C179735 [TUS-32-I13] Trace: SGN-T185752 EST: SGN-E373089 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373088Length: 508 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373088 [] (trimmed) GGAAAAAAAGGGACATTATCTTCATTACAAAATACAAAAATATATCTCCATTTTGATGCCCAAAAAAAACATTAGTAATTTGAAAAAAGAAAAAA
AAAAGGGAAAGAGCCCTTGTCACTGTAACATTTATAAGGGGTCTAGTTTAACCAGGTTGAATCAAAACTGTTCAGGGCAACAATGGGACTTTCCA
CAAGCTAATTGGGAACATGAACAGGAATCAGGTTTTCCATGGGTGGTAAATGTACTATTCCTGTCCAAAAAAGGGTAGGGCACTAGTTATTTTAA
CACATTTTTTGGGTCGTTTATGGCGCCAATTCCCATGACAACCTAAAAGTTATCCTTGGCCCGGGGAAGGGCTCCCAAGGCTTCTCCATCATTTG
CAGGGGCTGGAATGTTCAGCAACTTCCGGATTTTTGTACTTGAAGTTCGAAAAAAGGGATTACATAGCTTCTTTGCTTTCAGGGTTGTGGGAATT
GTGGGCAAGCCCTTCCTGCGAAAATTGGCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373088] SGN-U568791 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185751 [Download][View] Facility Assigned ID: FA0AAD20AE07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0200 Quality Trim Threshold: 14.5