EST details — SGN-E373353
| Search information |
| Request: 373353 | Match: SGN-E373353 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C179373 | Clone name: TUS-31-J11 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C179373 is on microarray TOM1 spot ID 1-1-6.2.2.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C82139 [cLET-1-A22] | Trace: SGN-T102605 | EST: SGN-E292331 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E373353 | Length: 148 bp (928 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E373353 [] (trimmed)
TTTCCCAACTTTGTAGCTTCGTTTTTGTTTGATTGATTTTTCTGTTGCTGATAAATTATCATTTAGAAAAAAAATTTGATTTAGGTGTTAGTCCC
CCCCAAAACAATCTAAAGTTGACAATTCCTAGTAATTTAATTTGTTAGCTTTT
CCCCAAAACAATCTAAAGTTGACAATTCCTAGTAATTTAATTTGTTAGCTTTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E373353] | SGN-U579047 | Tomato 200607 | Build 2 | 23 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T185491 [Download][View] | Facility Assigned ID: FA0AAD19CE06RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.841 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |


