EST details — SGN-E373517

Search information 
Request: 373517Match: SGN-E373517
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179330Clone name: TUS-31-H16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179330 is on microarray TOM1 spot ID 1-1-1.4.2.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77368 [cLES-20-L21] Trace: SGN-T102272 EST: SGN-E290593 Direction: 5' Facility: TIGR
Clone: SGN-C179330 [TUS-31-H16] Trace: SGN-T185654 EST: SGN-E373516 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373517Length: 556 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373517 [] (trimmed) TAGAATTTTATTGAAGTAAATGGAATCACAGTTTATTGAAAGATACCATAGTCATCAGCCTAGTGAACATCAGTGTTCTTCATCTCTTGTTAAAC
ACATCAAAGCACCAGTTGATATTGTAAAAATCATATCTTTTTTAGAATTATTCTCTTGATTTCTTGATTTGGGAGTAATTTTTATTTTGTGGGGT
TGGGGGTTCTTGAGGATTTCTCTTATTTATTTCTAGTTATACGACATTGGGTTTGTATAACATGATTGTATCTTTTTGTTCTATCTTTTCCTTAT
TTGTTGGGATACTAATCTTTTGGTTCCTTGTGTGTTTATTTGTGGAAAGTAATGTTTGTTTGGTAAGTTTTCTTTGAAAGGTTTTTTTTTTTCGA
ATTCCTAGCTAACTATTGGTGACTATGAAATTTGATCAGATTTTCGAAGTCTAATTAGTTTCATATTCAAATATCTTTTCAAGTTCCCAAAATCT
GGATAGGATTTTCGGGACTTCCAATAAGAGAAATCTATGGTCAAACAATACCTTATCGAAAATCTTTCTTGGGTGAGGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373517] SGN-U577680 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185655 [Download][View] Facility Assigned ID: FA0AAD19DD08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5