EST details — SGN-E373565

Search information 
Request: 373565Match: SGN-E373565
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179528Clone name: TUS-31-P22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179528 is on microarray TOM1 spot ID 1-1-3.4.2.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179528 [TUS-31-P22] Trace: SGN-T185702 EST: SGN-E373564 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373565Length: 583 bp (878 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E373565 [] (trimmed) GGAAGTTGAAGCTGATGTTGCGACCGGACAGCCAAGGAAGAGAACATTCAAGAAGTTCAGCTACAGAGGAGTAGATCTGGATTCTCTTCTTGACA
TGTCTACTGATGAGCTTGTTAAGCTTTACCCTGCTCGTCCTCGCAGAAGGTTCCAGAGGGGTTTGAAGAGGAAGCCTATGGCTTTGATCAAGAAG
CTGCGCAAGGCGAAACGTGAGGCCCCACCTGGTGAGAAGCCAGAGGTTGTGAGAACACATTTGAGGAACATGATCATTGTTCCTGAGATGATTGG
AAGTGTCATTGGAATCTACAATGGAAAAACTTTCAATCAAATTGAGGTCAAGCCTGAGATGATTAGTCACTACTTAGCTGAGTTCTCCATCTCAT
ACAAGCCTGTCAAGCACGGTAGGCCCGGTATTGGTGCTACTCACTCTTCAAGGTTCATTCCATTGAAGTGATTCATCCAAATCTGTCTACATGGT
TTCTAGTAATACTAGTACTTTTGTTTTACTGCAATTTTGATGAGAACAGTGGATACTGAATGGTTCTTTGTTTGAGACTAGTAATTTGCTGATAC
ATTGCAACATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373565] SGN-U577715 Tomato 200607 Build 2 166 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185703 [Download][View] Facility Assigned ID: FA0AAD19DH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5