EST details — SGN-E373853

Search information 
Request: 373853Match: SGN-E373853
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179298Clone name: TUS-31-G8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179298 is on microarray TOM1 spot ID 1-1-1.3.2.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77285 [cLES-20-H5] Trace: SGN-T102256 EST: SGN-E290577 Direction: 5' Facility: TIGR
Clone: SGN-C179298 [TUS-31-G8] Trace: SGN-T185296 EST: SGN-E373854 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373853Length: 511 bp (923 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373853 [] (trimmed) GCTAAGTGAAAACTCTAATACATAATATACTATCATTCAACACTTGGTAAAATATAAAAATGCTTCTTTTGCAATAGTATGAGACCTGTCCATCT
AAGCAAAACTTACACTAACTTGAATTTCTTTTGATCACTAGAGTAAATTGAATTCTACAGTGTAGATTTTTAGACAAAGTAATTGGAAGGGCAAT
TCTACTGTGAGTAGATTGCAGTAATCTCCCAATAAATATGAACTTATATCACAACCTTCAAAAATATTTGATCGACACTCAACATAATGTGCTCG
GCAATAGTAAAAGAATCTCCTTTGCATGAAATTCAGGGTAGCTACGAGTTTCCGAATGATACATTCAGTCATTACGCCTCCGCTTCCGAAAATGC
CTGAGGATAAAACTGTCAGCATAGAGTGGATAGTTTTTTCTAATTAACCCCTTTATGCATTTCCAGTATGAAAAGTCCACTGTTTCACCATCCTT
GCGGACAATAAATAAACATCTTGAGTTTTCAAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373853] SGN-U570991 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185295 [Download][View] Facility Assigned ID: FA0AAD19BD04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5