EST details — SGN-E373859

Search information 
Request: 373859Match: SGN-E373859
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179312Clone name: TUS-31-G22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179312 is on microarray TOM1 spot ID 1-1-3.3.2.16 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77321 [cLES-20-J2] Trace: SGN-T102138 EST: SGN-E290459 Direction: 5' Facility: TIGR
Clone: SGN-C179312 [TUS-31-G22] Trace: SGN-T185302 EST: SGN-E373860 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373859Length: 369 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373859 [] (trimmed) AAACCTGGCGTTGGATGCGCAGGTGCAGAACCATTAAACTGCGACGGTCCTACCCGTCCTTCTACATGTTGCTCCTGCTTAAGTTTAGAATAAAT
CTGACGAAGCTTCTCGCCAGACAAATTTGAAAATGTTGAGACATAATTCCATAAACGGACTGTCATCCTTTCTTGCTTATGTGATTCGTTCTCAT
ATTCAAAAACTATTTGATCAATCCTGCGACCAAGAAGCTGCAAGTAGTTCCGTATTTTGGCCAACACCTTGTCCTTGGGGAGATCAGCACTAGTA
GTCTGCAATCTTTGAAGACGCTTAAGCGTCTTTTCCTCATACACCATCACATCTTCACACCATTCCATCCATTTCACCTCTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373859] SGN-U583651 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185301 [Download][View] Facility Assigned ID: FA0AAD19BD11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5