EST details — SGN-E373861

Search information 
Request: 373861Match: SGN-E373861
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C179340Clone name: TUS-31-I2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C179340 is on microarray TOM1 spot ID 1-1-7.1.2.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77396 [cLES-20-M8] Trace: SGN-T102070 EST: SGN-E290391 Direction: 5' Facility: TIGR
Clone: SGN-C179340 [TUS-31-I2] Trace: SGN-T185304 EST: SGN-E373862 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E373861Length: 463 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E373861 [] (trimmed) AAACCAAAAAAATGGTATTTATTGTAAGATTAAAAGAAGCTACATGTTTACCAGTGCAAGCATAATCATGCTATTGACAGCAGAGCACTGAGACA
GGTCCAAACTTGAGTTTACATTTAAGGCATTCATGACCATCATTACATGATTTTATGGAAATTAGGAAGCAGAGGTCCAGAAATGTTCAAAAAGA
CAGCAAAAACAAATTGTTGAACTGAATGCAACTTTAGGTTCGCAATTCTCAGCAGCCTTTAGGCAAGAGACTCCCGCTTTTTGTTTTCTCTGATT
AGCTCTGCTCTCATTCTTCTGATTTCTGCTTCCTTCTCCATTCTCTCTTGCTTCTCATCCTGATGAAGAGCGATCCAGACATGAATTTTGTCCAT
GGTTTGCCAGAAAGCGAAGGCTCCTACAGACATAGCAAAGAACGTCGCAACTTTCACCATTTTCGCTAAGCTTTTGAGTCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E373861] SGN-U573807 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T185303 [Download][View] Facility Assigned ID: FA0AAD19BE01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5