EST details — SGN-E374846

Search information 
Request: 374846Match: SGN-E374846
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173109Clone name: TUS-15-E11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173109 is on microarray TOM1 spot ID 1-1-6.1.20.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1614 [cLEC-13-F24] Trace: SGN-T26022 EST: SGN-E204269 Direction: 5' Facility: TIGR
Clone: SGN-C173109 [TUS-15-E11] Trace: SGN-T188489 EST: SGN-E374845 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E374846Length: 385 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E374846 [] (trimmed) CACCGCCACTGCCTTCACCAGTAGCTTCAGGAGTGCAAGCAAAGTCGAAGTTCCCACTGAAATCGATGAAAATCTATTCTTCACAGTTGGATTGG
GACTCAACAATTGCCCTGCAGGGGCAAGTTCCAGCAGCTGTCAAGGTCCAAATGGAATGCGATTCACTGCCAGTATGAACAATGTGTCATTTGTG
TTACCATCCAATTTCTCCTTACTGCAAGCACATCACCAGGGAATACCTGGAGTTTTCTCAACAGATTTCCCATCAAGCCCACCCGTTAAATTTGA
TTACACTGGTAATGTTAGCAGGTCACTCTGGCAACCTATTTCCGCGACTAAAGTATACAAGTTAAAATATGGCGCGAGAGTACAGATTGTGTTAC
AGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E374846] SGN-U569011 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188490 [Download][View] Facility Assigned ID: FA0AAD3AC06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5