EST details — SGN-E375134

Search information 
Request: 375134Match: SGN-E375134
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180331Clone name: TUS-34-B9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180331 is on microarray TOM1 spot ID 1-1-8.2.19.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C45464 [cLEG-7-N2] Trace: SGN-T65230 EST: SGN-E250783 Direction: 5' Facility: TIGR
Clone: SGN-C180331 [TUS-34-B9] Trace: SGN-T187035 EST: SGN-E375133 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375134Length: 261 bp (1045 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E375134 [] (trimmed) GGCCACTCGAAAGTGGTAGTGAAGATGAAGTAGGTGGAAGTGGTAACACATTTGGTAATTAATGAGATCCGGTTGTCAGGTCTTTAAGCAGTGTT
AAGGTACTGTATAGTTGTTGTTACTACTAATTAGGAACATCCAAGAGAATAATTTTGCCATAGATCTGCTGGAGAATTGTAAATCATGATGCATA
ATCACGCTTCTGCCAATAATCAAACAAAGCAGTGTTAAAATCCTGTAATTTTTGTTATGGGCAATTCATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375134] SGN-U572525 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187036 [Download][View] Facility Assigned ID: FA0AAD22CA05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5