EST details — SGN-E375448

Search information 
Request: 375448Match: SGN-E375448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180390Clone name: TUS-34-D20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180390 is on microarray TOM1 spot ID 1-1-5.4.19.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C33309 [cLEG-26-E4] Trace: SGN-T68195 EST: SGN-E253272 Direction: 5' Facility: TIGR
Clone: SGN-C180390 [TUS-34-D20] Trace: SGN-T187217 EST: SGN-E375449 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375448Length: 189 bp (992 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375448 [] (trimmed) TTGCTTACTATTAATCTATGTTACAATTTCTGTGAGTGTAAAATCCTTTGCTAAATCATTTAATTTCCAGTACTAGTAATAAGTATACATTGGTA
ATCATGTCATCTTTTGCGACCCGAGACAGTTTTTTTACTGCTCCCACAGACACTAAGAAGTGATCCGGGATGATAGGGTCCTCATGTATCTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375448] SGN-U570184 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187216 [Download][View] Facility Assigned ID: FA0AAD22DB10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5