EST details — SGN-E375448
| Search information |
| Request: 375448 | Match: SGN-E375448 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C180390 | Clone name: TUS-34-D20 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C180390 is on microarray TOM1 spot ID 1-1-5.4.19.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C33309 [cLEG-26-E4] | Trace: SGN-T68195 | EST: SGN-E253272 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C180390 [TUS-34-D20] | Trace: SGN-T187217 | EST: SGN-E375449 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E375448 | Length: 189 bp (992 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E375448 [] (trimmed)
TTGCTTACTATTAATCTATGTTACAATTTCTGTGAGTGTAAAATCCTTTGCTAAATCATTTAATTTCCAGTACTAGTAATAAGTATACATTGGTA
ATCATGTCATCTTTTGCGACCCGAGACAGTTTTTTTACTGCTCCCACAGACACTAAGAAGTGATCCGGGATGATAGGGTCCTCATGTATCTGGA
ATCATGTCATCTTTTGCGACCCGAGACAGTTTTTTTACTGCTCCCACAGACACTAAGAAGTGATCCGGGATGATAGGGTCCTCATGTATCTGGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E375448] | SGN-U570184 | Tomato 200607 | Build 2 | 16 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T187216 [Download][View] | Facility Assigned ID: FA0AAD22DB10FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.927 | Expected Error Rate: 0.0088 | Quality Trim Threshold: 14.5 |


