EST details — SGN-E375702

Search information 
Request: 375702Match: SGN-E375702
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180751Clone name: TUS-35-C21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180751 is on microarray TOM1 spot ID 1-1-4.3.17.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34824 [cLEG-32-G15] Trace: SGN-T69580 EST: SGN-E253604 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375702Length: 207 bp (918 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E375702 [] (trimmed) ATACGATTAAGACAATCAATTGATGGTAAACCAAAAATATAATATGCACTTGTATTAAAGAACATAGTACCCCTTTCTCATCTAGTTGCTAATCC
ATTGATTAAGCATTGAATCTGCAATCTTTAAGTCATGAGCCTGCTCAGGAGCAGGGGGTCTTCTCCAACAAAAGTCAATCTTTCAATCCTTTGGC
AAAAAGCACTTTCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375702] SGN-U568957 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187470 [Download][View] Facility Assigned ID: FA0AAD23AB11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5